The rather advanced AT shift of the pseudogenes is consistent with runaway accumulation of random mutations. MLBr00038 has a G+C content of only 47% and appears to be an analog of Type VII secretion protein EccE from Mycobacterium malmoense (and others), which has a G+C content of 72%. TACCTTGGTTAGGGCATAGCCGCTGTGCAGCTGCACAGCGGCTATGCCCTAACCAAGGTA Its function, if any, is of course unknown.Ī palindrome of length 60 can be found in pseudogene MLBr00038: The palindrome is long enough to fold back on itself to produce a hairpin-like secondary structure of substantial size. ![]() The pseudogenes on either side of it have G+C contents of 59% and 60%. The pseudogene in question, of length 489 bases, is flanked on one side by a pseudogene that appears to be an analog of a 23S rRNA methyltransferase, and on the other side by a pseudogene that is an analog of a putative "integral membrane protein." tuberculosis soluble secreted antigen MPT53. It occurs precisely once (hence is not a CRISPR) in pseudogene MLBr01586, which appears to be an analog of M. ![]() This is a true palindrome (in that the reverse complement of the sequence exactly equals the sequence). GGTGCTTGTTTTGCAATCTCGACCATTACCTGGCCTTAAGGCCAGGTAATGGTCGAGATTGCAAAACAAGCACC I have found a number of sizable palindromes in Mycobacterium leprae Br4923.
0 Comments
Leave a Reply. |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |